Review



pbluescript sk ii (+) vector plasmid  (Agilent technologies)


Bioz Verified Symbol Agilent technologies is a verified supplier
Bioz Manufacturer Symbol Agilent technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Agilent technologies pbluescript sk ii (+) vector plasmid
    Pbluescript Sk Ii (+) Vector Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pm39082859-55-10-16
    Average 90 stars, based on 1 article reviews
    pbluescript sk ii (+) vector plasmid - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a nucleomorph-encoded open reading frame from the cryptophyte Guillardia theta
    Article Snippet: .. Both were ligated into the pGEM-T vector (Promega, Mannheim) and after verification of the sequence, transferred into the pBluescript II SK (Stratagene, Amsterdam) vector. ..

    Article Title: The Transposon Galileo Generates Natural Chromosomal Inversions in Drosophila by Ectopic Recombination
    Article Snippet: .. DNA fragments of interest from positive phages were subcloned into pBluescript II SK vector (Stratagene). ..

    Article Title: Identification of sugar response complex in the metallothionein OsMT2b gene promoter for enhancement of foreign protein production in transgenic rice.
    Article Snippet: Key message A 146-bp sugar response complex MTSRC is identified in the promoter of rice metallothionein OsMT2b gene conferring high-level expression of luciferase reporter gene and bioactive recombinant haFGF in transgenic rice.. Abstract A rice subfamily type 2 plant metallothionein (pMT) gene, OsMT2b, encoding a reactive oxygen species (ROS) scavenger protein, has been previously shown to exhibit the most abundant gene expression in young rice seedling.. Expression of OsMT2b was found to be regulated negatively by ethylene and hydrogen peroxide in rice stem node under flooding stress, but little is known about its response to sugar depletion.

    Article Title: Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri
    Article Snippet: The lengths of PCR products were determined by comparison with DNA size markers (100 bp DNA marker, Fermentas, St. Leon-Rot, Germany and 1 kb DNA ladder, Invitrogen, Carlsbad, CA). .. Products of PCR amplification were cloned into the pBluescript II SK vector (Stratagene, La Jolla, CA) and sequenced. .. For standard RT-PCR, first strand cDNA synthesis was performed using Moloney murine leukemia virus (MMLV) reverse transcriptase lacking ribonuclease H activity (H minus) (Promega, Madison, WI).

    Article Title: Leishmania major Methionine Sulfoxide Reductase A Is Required for Resistance to Oxidative Stress and Efficient Replication in Macrophages
    Article Snippet: .. An overlap PCR was then performed using these PCR products as template, and the resultant product cloned into the HindIII/NotI sites of the pBluescript II SK vector (Stratagene, CA, USA). ..

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Sequencing:

    Article Title: Complementation of a phycocyanin-bilin lyase from Synechocystis sp. PCC 6803 with a nucleomorph-encoded open reading frame from the cryptophyte Guillardia theta
    Article Snippet: .. Both were ligated into the pGEM-T vector (Promega, Mannheim) and after verification of the sequence, transferred into the pBluescript II SK (Stratagene, Amsterdam) vector. ..

    Synthesized:

    Article Title: Identification of sugar response complex in the metallothionein OsMT2b gene promoter for enhancement of foreign protein production in transgenic rice.
    Article Snippet: Key message A 146-bp sugar response complex MTSRC is identified in the promoter of rice metallothionein OsMT2b gene conferring high-level expression of luciferase reporter gene and bioactive recombinant haFGF in transgenic rice.. Abstract A rice subfamily type 2 plant metallothionein (pMT) gene, OsMT2b, encoding a reactive oxygen species (ROS) scavenger protein, has been previously shown to exhibit the most abundant gene expression in young rice seedling.. Expression of OsMT2b was found to be regulated negatively by ethylene and hydrogen peroxide in rice stem node under flooding stress, but little is known about its response to sugar depletion.

    Polymerase Chain Reaction:

    Article Title: Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri
    Article Snippet: The lengths of PCR products were determined by comparison with DNA size markers (100 bp DNA marker, Fermentas, St. Leon-Rot, Germany and 1 kb DNA ladder, Invitrogen, Carlsbad, CA). .. Products of PCR amplification were cloned into the pBluescript II SK vector (Stratagene, La Jolla, CA) and sequenced. .. For standard RT-PCR, first strand cDNA synthesis was performed using Moloney murine leukemia virus (MMLV) reverse transcriptase lacking ribonuclease H activity (H minus) (Promega, Madison, WI).

    Article Title: Leishmania major Methionine Sulfoxide Reductase A Is Required for Resistance to Oxidative Stress and Efficient Replication in Macrophages
    Article Snippet: .. An overlap PCR was then performed using these PCR products as template, and the resultant product cloned into the HindIII/NotI sites of the pBluescript II SK vector (Stratagene, CA, USA). ..

    Amplification:

    Article Title: Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri
    Article Snippet: The lengths of PCR products were determined by comparison with DNA size markers (100 bp DNA marker, Fermentas, St. Leon-Rot, Germany and 1 kb DNA ladder, Invitrogen, Carlsbad, CA). .. Products of PCR amplification were cloned into the pBluescript II SK vector (Stratagene, La Jolla, CA) and sequenced. .. For standard RT-PCR, first strand cDNA synthesis was performed using Moloney murine leukemia virus (MMLV) reverse transcriptase lacking ribonuclease H activity (H minus) (Promega, Madison, WI).

    Clone Assay:

    Article Title: Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri
    Article Snippet: The lengths of PCR products were determined by comparison with DNA size markers (100 bp DNA marker, Fermentas, St. Leon-Rot, Germany and 1 kb DNA ladder, Invitrogen, Carlsbad, CA). .. Products of PCR amplification were cloned into the pBluescript II SK vector (Stratagene, La Jolla, CA) and sequenced. .. For standard RT-PCR, first strand cDNA synthesis was performed using Moloney murine leukemia virus (MMLV) reverse transcriptase lacking ribonuclease H activity (H minus) (Promega, Madison, WI).

    Article Title: Leishmania major Methionine Sulfoxide Reductase A Is Required for Resistance to Oxidative Stress and Efficient Replication in Macrophages
    Article Snippet: .. An overlap PCR was then performed using these PCR products as template, and the resultant product cloned into the HindIII/NotI sites of the pBluescript II SK vector (Stratagene, CA, USA). ..

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Real-time Polymerase Chain Reaction:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Cloning:

    Article Title: Brain-specific glycosylation enzyme GnT-IX maintains levels of protein tyrosine phosphatase receptor PTPRZ, thereby mediating glioma growth.
    Article Snippet: Plasmids All PCR steps were performed using Tks Gflex DNA Polymerase (TaKaRa). .. Human PTPRZ-long (6948 bp) was cloned by real-time PCR using total RNA from LN-229 cells with the primers 5′-GGAATTCGATATCAAATGCGAATCCTAAAGCGTTT-3′ (forward) and 5′- ACGGTATCGATAAGCTTTAAACTAAAGACTCTAAG-3′ (reverse) and subcloned into the EcoRV site of the pBluescript II SK vector (Stratagene) using an In-Fusion HD Cloning Kit (TaKaRa). .. For C-terminal sPTPRZ754-His, extracellular regions of PTPRZ-long after the signal peptide were amplified using PCR with the primers 5′-CCGGCCAGATCTCCCTACTACAGACAACAGAGAAA-3′ (forward) and 5′- CGTCGACCTGCAGCCTTAGTGATGGTGGTGATGATGGTGGTGATGATGATTGTATACCGGTTGGGT-3′ (reverse) and inserted between the SmaI and SacII sites of pDisplay (Thermo Fisher Scientific).

    Marker:

    Article Title: A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences
    Article Snippet: .. Chemicals, enzymes and strains High-fidelity Taq DNA polymerase pyrobest , T4 DNA ligase, DL2000 DNA marker, restriction endonucleases, IPTG and X-Gal were purchased from Takara Co., Ltd (Dalian, People's Republic of China). pBluescript II SK vector was purchased from Stratagene (La Jolla, CA). .. High-fidelity Taq DNA polymerase Pfu was purchased from Promega (Madison, WI).

    Article Title: A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences
    Article Snippet: .. High-fidelity Taq DNA polymerase pyrobest , T4 DNA ligase, DL2000 DNA marker, restriction endonucleases, IPTG and X-Gal were purchased from Takara Co., Ltd (Dalian, People's Republic of China). pBluescript II SK vector was purchased from Stratagene (La Jolla, CA). .. High-fidelity Taq DNA polymerase Pfu was purchased from Promega (Madison, WI).



    Similar Products

    93
    Addgene inc pbluescript sk ii vector
    Pbluescript Sk Ii Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pBluescript+SK+%2B%2F-+mTRF1+(Plasmid+%2312303)/pmc12378376-105-30-33
    Average 93 stars, based on 1 article reviews
    pbluescript sk ii vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    99
    New England Biolabs ecori digested pbluescript ii sk vector
    Ecori Digested Pbluescript Ii Sk Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/EcoRI/bio_rxiv__2025__05__18__654697-221-8-14
    Average 99 stars, based on 1 article reviews
    ecori digested pbluescript ii sk vector - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript sk ii (+) vector plasmid
    Pbluescript Sk Ii (+) Vector Plasmid, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pm39082859-55-10-16
    Average 90 stars, based on 1 article reviews
    pbluescript sk ii (+) vector plasmid - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii sk (+) vector
    Pbluescript Ii Sk (+) Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/10__21926_slash_obm__genet__2401223-43-7-12
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk (+) vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii sk(+) vector
    Pbluescript Ii Sk(+) Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pm38171234-42-32-36
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk(+) vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    New England Biolabs ecoridigested pbluescript ii sk vector
    Ecoridigested Pbluescript Ii Sk Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/NEBuilder+HiFi+DNA+Assembly+Master+Mix/pm38165175-209-8-14
    Average 99 stars, based on 1 article reviews
    ecoridigested pbluescript ii sk vector - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Bio Basic Canada pbluescript ii sk (-) vector
    Pbluescript Ii Sk ( ) Vector, supplied by Bio Basic Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pbluescript+ks/pm37922568-69-21-26
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk (-) vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Agilent technologies pbluescript ii sk vector
    Pbluescript Ii Sk Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pm37543361-222-32-36
    Average 90 stars, based on 1 article reviews
    pbluescript ii sk vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation pskgdh pbluescript ii sk(+) vector with optimized synthetic gene for gdh from bacillus megaterium as1.223 (gdh)
    Pskgdh Pbluescript Ii Sk(+) Vector With Optimized Synthetic Gene For Gdh From Bacillus Megaterium As1.223 (Gdh), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbluescript+ii+sk+(+)+vector/pskgdh+pbluescript+ii+sk++++vector+with+optimized+synthetic+gene+for+gdh+from+bacillus+megaterium+as1+223++gdh+/10__1134_slash_s0006297923090146-48-130-139
    Average 90 stars, based on 1 article reviews
    pskgdh pbluescript ii sk(+) vector with optimized synthetic gene for gdh from bacillus megaterium as1.223 (gdh) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results